Genomics Tools

Genomic DNA

Genomic DNA Samples From Reference Accessions list

The DNA comes from a 'mini-core' collection developed in the framework of the Generation Challenge Programme (GCP). The collection is currently comprised of 52 Musa accessions taken from the Cirad collection located in Guadeloupe (west indies). It was assembled using the GCP criteria regarding the genetic diversity representation, the duplication at the Bioversity International Transit Centre (ITC), the use in breeding programmes and the FAO designation. 

For each of the accessions, ten extractions, each of three grams of frozen leaves were made with the Matab method (Risterucci et al., 2000). About 1 miligram of DNA was obtained per accession. The DNA samples are stored and distributed in PCR grade water.

The DNA samples are distributed to Musa research community via the Musa Genome Resource Centre (MGRC) based at IEB, Olomouc, Czech Republic upon request. The MGRC operates at a cost-recovery basis and the recipients are expected to cover packing and shipment costs. In order to have sufficient researchers benefiting from this service, a maximum of 1 μg of DNA per accession is provided and only under this <media 9402 _self internal-link "Initiates file download">agreement</media>.

Warning: Until we are able to provide the definitive fingerprinting profile, we cannot guarantee the identity of the DNA sample.

Sample Number Codes Name Section Species /Group Sub-species /Sub-group Country of collect Availability
1 ITC0582 Lady Finger Eumusa AAB India Yes
2 ITC0649 Foconah Eumusa AAB Pome / Prata Cameroon Yes
3 ITC0962 Prata Ana Eumusa AAB Pome / Prata Brazil Yes
4 ITC1587 Pisang Klutuk Wulung Eumusa balbisiana type 4 Indonesia
(IDN 056)
Yes
5 ITC1156 Pisang Batu Eumusa balbisiana type 4 Indonesia
(IDN 080)
Yes
6 ITC0623 Banksii Eumusa acuminata banksii Papua New Guinea Yes
7 ITC0253 Borneo Eumusa acuminata microcarpa Malaysia, S/E Borneo Yes
8 ITC0249 Calcutta 4 Eumusa acuminata burmannicoides India Yes
9 ITC0652 Kluai Tiparot Eumusa ABB Klue teparod Thailand (THA 020) Yes
10 ITC1325 Orishele Eumusa AAB Plantain Nigeria Yes
11 ITC0472 Pelipita Eumusa ABB Pelipita Philippines Yes
12 ITC0767 Dole Eumusa ABB Bluggoe Yes
13 GRN Grande Naine Eumusa AAA Cavendish Guadeloupe Yes
14 ITC0420 Pisang Kayu Eumusa AAA Orotav Indonesia
(IDN 098)
Yes
15 ITC1028 Agutay Eumusa acuminata errans Philippines Yes
16 ITC0660 Khae (Phrae) Eumusa acuminata siamea Thailand
(THA 015)
Yes
17 ITC0769 Figue Pomme Geante Eumusa AAB Silk Guadeloupe Yes
18 ITC1138 Saba Eumusa ABB Saba Philippines Yes
19 ITC1064 Pisang bakar Eumusa AAA Ambon Indonesia
(IDN 106)
Yes
20 ITC1483 Monthan Eumusa ABB Monthan India Yes
21 ITC1120 Tani Eumusa balbisiana Yes
22 ITC0283 Long Tavoy Eumusa acuminata burmannica Yes
23 ITC0245 Safet Velchi Eumusa AB cv India Yes
24 ITC0654 Petite Naine Eumusa AAA Cavendish Yes
25 ITC0766 Paliama Eumusa Acuminata banksii Papua New Guinea (PNG 067) Yes
26 ITC1482 Poyo Eumusa AAA Cavendish Nigeria Yes
27 ITC0335 Popoulou Eumusa AAB Popoulou/Maia Maoli Cameroon Yes
28 SRDJ Simili Radjah Eumusa ABB Peyan From India through DRC Yes
29 ITC1481 Gros Michel Eumusa AAA Gros Michel Guadeloupe Yes
30 ITC1152 Wompa Eumusa AS Papua New Guinea (PNG 063) Yes
31 ITC1034 Kunnan Eumusa AB cv India, Kerala Yes
32 ITC0312 Pisang Jari Buaya Eumusa AA cv (18) Pisang jari buaya Malaysia, kelatan Thai border Yes
33 ITC0653 Pisang Mas Eumusa AA cv (2) Sucrier Malaysia Yes
34 ITC0843 Pisang Raja Bulu Eumusa AAB Pisang raja Indonesia
(IND 093)
Yes
35 ITC0277 Leite Eumusa AAA Rio Yes
36 ITC0020 Ice Cream Eumusa ABB Ney Mannan Yes
37 ITC1177 Zebrina Eumusa acuminata zebrina Indonesia Yes
38 ITC1187 Tomolo Eumusa AA cv Cooking AA Papua New Guinea (PNG023) Yes
39 ITC0247 Honduras Eumusa balbisiana type 1 Honduras (seeds) Yes
40 BVEL Lal Velchi Eumusa balbisiana type 3 India Yes
41 ITC0659 Namwa Khom Eumusa ABB Pisang Awak Thailand
(THA 011)
Yes
42 ITC0084 Mbwazirume Eumusa AAA Lujugira/Mutika Burundi Yes
43 ITC0082 Intokatoke Eumusa AAA Lujugira/Mutika Burundi Yes
44 ITC1123 Yangambi km5 Eumusa AAA Ibota DRC Yes
45 ITC1140 Red Yade Eumusa AAB Plantain Cameroon Yes
46 ITC0243 Pisang Rajah Eumusa AAB Nendra padaththi Malaysia Yes
47 ITC1238 Yawa 2 Eumusa x Australismusa ABBT ABBT Ssp/sgr 501 Papua New Guinea (PNG 072) Yes
48 ITC1441 Pisang Ceylan Eumusa AAB Mysore Malaysia Yes
49 ITC0856 Schizocarpa Eumusa schizocarpa Papua new Guinea Yes
50 ITC1072 Textilis Australimusa textilis Yes
51 ITC0637 Musa ornata Rhodochlamys Ornata Ornata Yes
52 ITC1511 DH Pahang (Cirad930) Eumusa acuminata malaccensis Guadeloupe Yes

22 SSR markers enabling distinction between the 52 reference accessions

Name Motifs Forward sequences (5'-3') Reverse sequences (3'-5') T size (bp) Alleles
mMaCIR03 (GA)10 TGACCCACGAGAAAAGAAGC CTCCTCCATAGCCTGACTGC 55 110-138 14
mMaCIR07 (GA)13 AACAACTAGGATGGTAATGTGTGGAA GATCTGAGGATGGTTCTGTTGGAGTG 53 146-184 18
mMaCIR08 (TC)6N24(TC)7 ACTTATTCCCCCGCACTCAA ACTCTCGCCCATCTTCATCC 55 252-298 12
mMaCIR13 (GA)16N76(GA)8 TCCCAACCCCTGCAACCACT ATGACCTGTCGAACATCCTTT 53 270-298 12
mMaCIR39 (CA)5GATA(GA)5 AACACCGTACAGGGAGTCAC
GATACATAAGGCAGTCACATTG 52 329-369 20
mMaCIR40 (GA)13 GGCAGCAACAACATACTACGAC
CATCTTCACCCCCATTCTTTTA 54 168-206 17
mMaCIR45 (TA)4CA(CTCGA)4 TGCTGCCTTCATCGCTACTA
ACCGCACCTCCACCTCCTG 57 272-294 9
mMaCIR152 (CTT)18 CCACCTTTGAGTTCTCTCC
TTTCCCTCTTCGATTCTGT 54 158-194 13
mMaCIR195 (GA)17 GAATCGCCTTAGTCTCACC
TCATGTGCTCCCATCTTT 54 239-295 16
mMaCIR214 (AC)7 CCATTGAGAGATCAACCC
CTATTTGACGTTGGTGGTC 53 115-135 6
Ma1_32 (GA)17AA(GA)
8AA(GA)2
GGAACAGGTGATCAAAGTGTGA TTGATCATGTGCCGCTACTG 60 227-270 20
Ma3_90 - GCACGAAGAGGCATCAC GGCCAAATTTGATGGACT 53 142-176 18
mMaCIR01 GA(20) TTAAAGGTGGGTTAGCATTAGG TTTGATGTCACAATGGTGTTCC 55 238-314 22
mMaCIR150 (CA)10 ATGCTGTCATTGCCTTGT GAATGCTGATACCTCTTTGG 54 257-270 5
mMaCIR164 (AC)14 AAGACAAGTTCCATTGCTTG GTTCGGGCTTTCGGT 55 255-409 17
mMaCIR196 (TA)4, (TC)17, (TC)3 GCTCCAAACCTCCCTTT CGATGCCACACTGGAC 55 168-192 12
mMaCIR231 (TC)10 GCAAATAGTCAAGGGAATCA ACCCAGGTCTATCAGGTCA 55 238-286 19
mMaCIR24 (TC)7 ATCTTTTCTTATCCTTCTAACG ATTAGATCACCGAAGAACTC 48 237-297 19
mMaCIR260 (TG)8 GATGTTTGGGCTGTTTCTT AAGCAGGTCAGATTGTTCC 55 194-230 13
mMaCIR264 (CT)17 AGGAGTGGGAGCCTATTT CTCCTCGGTCAGTCCTC 53 234-274 23
mMaCIR27 (GA)9 GGGGAACAGCACGGTCACAT CCACTCCCCCAACAACACGA 58 231-259 12
mMaCIR307 (CA)6 AGACTTGTATCGCTTGGTAAA ACGCTGCACCAGTCAA 54 160-172 6

Protocol for DNA amplification and detection

SSR patterns of each individual of the study were analysed following the protocol of Roy et al. (1996) applied with the automated infrared fluorescence technology of a sequencer LICOR IR2 (LICOR, Lincoln, USA). For a given SSR locus, the forward SSR primer was designed with a 5'-end M13 extension (5'-CACGACGTTGTAAAACGAC-3').
The PCR amplification was performed in a 384 wells Eppendorf mastercycler with 10 ng of Musa DNA in a 10µl final volume of buffer (10 mM Tris-HCl (pH 8), 100 mM KCl, 0.05% w/v gelatin, and 2.0 mM MgCl2) containing 0.08 µM of the M13-labelled primer, 0.1 µM of the other primer, 160 µM of dNTP, 1 U of Taq DNA polymerase (Life Technologies, U.S.A.) and 0.06 µM of M13 primer-fluorescent dye IR700 or IR800 (Biolegio, Netherlands).

The PCR programme contain an initial denaturation step at 94°C for 5 min; a touch-down protocol involving initial decrease of annealing temperature by 1 ºC for the first cycles depending on the primer pairs used, and a fixed annealing temperatures for further 35 cycles. In all cases denaturation occurred  at  94°C for 45 s, annealing at lowest TM of primer (between 43 et 52°C) for 60 s, and elongation at 72°C for 60 s. A final elongation step at 72°C for 5 min is added to all the protocols.

In each plate of PCR a Musa standard made with a mix of three Musa accessions (Pisang Jari Buaya, Popoulou/Maia Maoli and Tomolo) is added in order to improve allele sizes determination.
For each run a ladder (range 71-367 bp) is added at the hedges of the gel. IR700 or IR800-labeled PCR products were diluted 8-fold and 5-fold respectively, subjected to electrophoresis in a 6.5% polyacrylamide gel and then sized by the IR fluorescence scanning system of the sequencer.